circad | circRNAs associated with diseases

hsa_circ_0000993
Gene	n/a	Organism	Human
Genome Locus	chr2:38545676-38546161:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30215537
Experimental Method
Sample Type	Cell Lines	Comparison	Human gastric cancer cell lines SGC-7901 and BGC-823 were purchased from the Cell Bank of the Chinese Academy of Sciences
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTGCTGTGCTGCTTATGGA Reverse CTCGCCATGTAAAGCCTGTC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhong, S, Wang, J, Hou, J, Zhang, Q, Xu, H, Hu, J, Zhao, J, Feng, J (2018). Circular RNA hsa_circ_0000993 inhibits metastasis of gastric cancer cells. Epigenomics, 10, 10:1301-1313.